Was this page helpful?

Group 6, Gene IV

    Table of contents
    No headers

    Gene IV was predicted by both GeneMark and FGENESH. GeneMark (Gene #16 in GeneMark) predicted that the gene had 5 exons (107366 - 107487; 107628- 107893; 110482- 111032; 111128- 111547; 111642-    111989) and FGENESH (Gene #21 in FGENESH) predicted that the gene had also 5 exons (107366 - 107487; 107628 - 107893; 110437 - 111032; 111128 - 111547; 111642 - 111989). We ran a nucleotide BLAST search in the refseq_rna database using both predictions and found that the FGENESH prediction gave a little bit better hits. We concluded that FGENESH made a better prediction of this gene and based our gene model on the FGENESH prediction.

     

    Gene IV Model:

     

    -predicted identity: amino acid permease (GABA permease) (membrane protein  involved in the transportation of amino acids into the cell)

    -number of exons: 5

    -bp range: 106316 - 112360 in group 6 sequence

    -exon 1: 107366 - 107487

    -exon 2: 107628 - 107893

    -exon 3: 110437 - 111032

    -exon 4: 111128 - 111547

    -exon 5: 111642 - 111989

    -starts with start codon: Yes

    -ends with stop codon: Yes

    -all splice sites appear correct: Yes

    -nucleotide sequence:

    -start codon in green, stop codon in red, exons in red letters

    TATATACCAATCCTCTCAATGCCACTGGAAATTGA

    TTTGATCTGTTTGGGTTTTAAAAACCCAGAATAAAAAAATATAGACCAAA

    GTTTAGTCCATACTTTTTGAAACCCCAAAATTACTCCAATATATCAGTTT

    GATCTATTTGCTTCCTAATAGTTTTAAAAAAAATATGAAAAATTGAATAG

    ATCGAATCAGTATAAATGAATAACCACATAGTTTTCTAGGTTCTAAAAAA

    TGTAGACTGAAATTTTAAAAAAAAATTATTTAAAATCTTTGTTCATATCA

    ATTAAGAATAATATAAAGAGTCTCTTGGATTGCTCTCCTCCAATGCATAA

    ATTTGCATATACATTATCTATTGGAGAAACAAAATTTTATATGTCACACG

    TATATGTTGTTCATTATACAAATAGCCAAATGACTCTAAAACTTATTTGC

    TTGTTAGAGCTAGGGCCAGAGAAACACAAGTGCGTGCTTTTTTTTATTCT

    GGAATTTTTAAATTGAAATAGATCGAACCAATTTCTATTGGTGTTGAAGG

    GATCAATATATGTTTTGATGACATTAGAGGGATTTGTTTTTAATGGAACT

    AAGGGCGATGGCATTCAGGGATTAAAATTTAAATTTGATGGCATTGAAAG

    GAAGCTATAAATTATGATTGCATTAAAGGGATTGGTATAAGTTTGGATGT

    TATTGAAGAGATTTTCTTAAAATAAGATCTTATTCGGTTATTTCCGTATC

    ATATGAATTGGATAAAATTGAAAAAAAAATTATGAAATATTTTGACTTAT

    TTAGAATTTAAATTTATTCAATTCACAAAGATTGAGAGGAAAACGAATAA

    ATCAGGGTTTAACTAACAAATCCTGGCCCAGCAACCACATTGATGCCCGT

    CCCCCAACGCACTTTCGAGTTGACTTATTAGCAGCCGCGCCCAGAGCAGC

    CACACTTCTTTCCGTTCCACCCTTCCTTCAAGACGCAGCACCCATATATC

    CTCCCGGTGTCCGGCGTCCTCCCCTTGCCTCAAGCACATCGTCTCCTACC

    GCAGTACACAACCTCCGGCAACGACTCGGTCACGGAGCTAGCTAGAGACC

    GACGCGGCGCGCGCCATGACGTGGAACAGGTCCCCGGCCGGTGGCGGCAG

    CGCCGTGACCGTCGACCACAGTGACGACACCGGCCTGGCGCGCTTGCGGG

    AGCTCGGGTACAGGCAGGAGCTGAAGCGCGACCTCTCGTACGTTCCTCGT

    CACCTCCGTCAGCTTTCGCCTTCTTTCTTCCGTTAGTTCGTTCCCTCGCT

    CGTTCGGTCACTCACATTCGCGTCCGTTGGTTCGATCGACGACGGCGACC

    GCGCGCGCTCGCTTGTCTGTTTGCCAGGGTGCTGTCCAACTTCGCATTCT

    CCTTCTCCATCATCTCGGTGCTGACGGGGGTCACGACGCTCTACAACACG

    GGGCTCAACTTCGGCGGCCCCGCCACCATGACCTTCGGCTGGTTCGTCGC

    CGGCGCCTTCACCATGGCCGTCGGCGCGTCCATGGCCGAGATTTGCTCCT

    CCTTCCCCACCTCCGGCGGCCTCTACTACTGGAGCGCTCGCCTATCCGGC

    AAGCGCTGGGCGCCCTTCGCCTCATGGATCACCGGATGGTACGGTAAGAT

    CGTTATCCGCTGGGCGCATTACGTGGAAAAAACTTTGGTGCAGCACTGCT

    GCAAAACAGTGTGTTTGCAGTCCCTCAAAAAAAAAGAGGATAGACTCCAC

    CTGCAGATCTACTAGATAACGTTTTATTTATATTATTGCTGCTGCGTGTG

    GGGTATATACTCCGTTTTGTGAGGGGCTGTAAACGTTCTAGTTTGCAGCA

    GTGCTGCACCAAATTTTTTTCTCATTACGTGGGCTAGTTTGAGAACTTTT

    TTCCAAATGATAATTATTTTTTCAATAGAAATTAATTTATTTGTTTTTAG

    AAAAATAGAAATCCTTTAGAAAAATAATAGTCCCAAATAGCCCTGAGAGT

    AGTGCTCGCCGCCGGGTTTCTTTTCTCGTTTTTGGAAACGGGAATTTTGT

    ACGGTTCAACTTTCAAGGAATCGGGGAAGATCATGTGAACTGCTTGGTTG

    TGTGTGAATTACAATATTTTTATTTTTTATGTTTTCAAGAAGAGTTGAAT

    CCATATGCCCTGGTCATTGGTCAATATGAGAGCTTTGACCTTAAGACTAT

    ATCAAACAACTTACATATTATATTTCTTATTTTAAACTTCATTTTACAAA

    CAGTGCAAAACAATGTATTAGAAATTTAGGTGACCATATGAATAACCTGT

    TGGACACAGTCTTATATAGGAAGGACATTGGTGCTCTGCTATAGGGACTA

    AATTTGCCAGTCCTATTATAAGGGTGTGTCAGTGTTAGAAATTTTCTTAA

    TATCTTCAGCATCTTACTCATCCATACCTCTCATTTCAAACTTCAATCTG

    TAAAAGGTGTATATACACAGTCTACTAACCATAGCTTAAGGAAGAAGGGG

    GTTCATGTGACAAGTTTAATCTATATCAAATCGAATATTTAAAAACATTA

    CGAGTATTAAATATAGTTTAATTACAAAATTAATTATACAGATAAATCAT

    AATGACGAGACACATTTATTAAGTGTAATAAATCAATAATTATAGCATCA

    CATGGACGAAGCATGAACTAATTAGACTTAATAGTTTTATGGTCCTTATA

    TGTATTATTAGTTTTATAATTATATTATATCTAATACTTCTTATTAGTAT

    AAACATACAATGTGATAAAGACTAAAATTTATTTCTAGTATGCAAATACC

    CCCTAAGTTCTAAGAAAGACAAGACTTCTAGCAGGTTTTTAAGATTTTGG

    CTCTGTATCGTAGAACTCTTTTAAAGGCTCCCTCAACAGTTTCTTAAAAA

    AATATACCAAACATGAGGTTTCTCTATTGACTTCATAAAAATACGAAGGA

    GCTAACTCCACGAGTGGAGCCAAAAAAAGAGTATCTCCGACTCTCTTTTG

    TCCTTCCCTTCATCATAAAAATAGGAGTAGCTATATTTTCAACCAAATGT

    AATACTCTAAGACTTCCTAAAAACAAGGAGAAAAATATTTTTTCTAGAGA

    AGCCAAAACTAGACCTGAAGCAGTATAGGGCCTTTGAATTGCGGTAGTGC

    TTGCGTATATGGTCGGGGGTTAACTAGTGGGGCAGCTATCTGATCAAGAG

    TTAAAACAATCATCAGGCTTTCAGTAAACGGTTGCTTCAGTTACATAGCA

    CAGTACAGTACAACATCGACAAGTAGGAATCGTTGTATTTGGGAGTTGCC

    AAATGTCAATGATCCCATCTCATTCATTCTCTCTTTAAATTTGTGAAGCA

    AACAAACTAATTAAGTTTCTATCACGTTGTTGATGTGGTCACCTGTTTTT

    TATTCCTGGATGAAATCAAGAACGAGACAATACAAATAAGTAAATTTATT

    CTTCTCCCGTTAATTAATTCTCCTCAAGGGTGTTAATATATTAAGAGAAG

    AAGGTAAAAGATAAATAGATAAGAATTGAAATGTAGATGGAGGGATCATA

    ACAAAAAAAAACATTTTAGATTACTCATCTTGTAGGTGTTAACCTTCTTC

    ATTCTTTTGTTAAATGATAATTATAAACATACCTTCGGCTTTACAGAAAA

    CAATGTGAAGGTAGAAAAACAACAAATACAAGCTTCGTAGAAACAACAAT

    TCAAATTTATCCCCCTGAAATCCGTGCCCGTATGCATGGCACTTTCCCAT

    GTTTCTAGTGGAAGAATACAACTTAGTAAAAAATAAAAACATGTCCATCA

    GTCTTATACACATTAACTACAAAAATCAACTAAGGGCATTGTTATCACTT

    CCTTCATGGCAGTGTTGAGCAAGCTTTGGAGATCTTGTCTTTTATCTCTG

    TAAACACATTACTACGAAGCCGAGGTCGTTGCTTCGTTTCTGTGTTCGTG

    TTCGTTGCTCATCGTTCCTGGATGAAGGTGACCTTCGTCGACTGCCCCGT

    TACACCTGAAATAGACTTAGAATCGTTTGAAAAATTAATGTTTTGAGAAC

    CTTTTCCTCAGAAAGTCCCTACACTATATATTTGATTCCAGCACATTTCT

    TTTCGCCCTCTAATCTAACCTAACATACGCGTGTCTTTTTTTGTGTGTTT

    GTCCGTGTGGCTTTCAGGTTCAATGTTGTTGGTCAGGTGAAACACCATTT

    TCCCGAACCCCGTTTTCTTTTTCCTGCAAAGTGACTGCTTTCTCGCTAGC

    TGAGCCTGAGCCGATCGAGGTCCTCACTCTCACAGTCTCACTCCTGCGTG

    CTGCTGTGCAGTGGGCGGTGACCACCAGCGTGGACTACTCCCTGGCGCAG

    CTGATCCAGGTGATCATCCTGCTGGCCACCGGCGGCAAGACCGGCGGCGG

    CTACGTGGCGTCCAAGTACATGGTGCTCGGCTTCCACGCCGCCATCTTGC

    TCAGCCACGCCGTCATCAACAGCCTCCCCATCAGCTGCCTCTCCTTCCTC

    GGCCAGTTCGCCGCGGCCTGGAACGTGCTAGGTAGCCTCCCTCCCATTCT

    CGATCTCTCTGCATGCACAGGCATCATCCTCCTGCTCGTGGCTGCAGGCG

    TCTTTGTCCTGATGATTGCCGTGCCGACCGTTGCCACCGAGAGGGCGAGC

    GCCGAGTTCGTCTTCACCCACTTCAACACCGACAACGACGGCGCCGGGAT

    CCGGAGCAGCCTGTACATCTTTGTCCTGGGGCTGCTCATGAGCCAGTACA

    CGTTCACAGGATACGACGCCTCTGCGCATATGGTACGTACGTACTTGAAC

    CTGGAGCAACACCGATTACGACCTTTGCGATCGATGCAGCGTCCTCTGTC

    TGTCCTGAATTCCTGACGCGGTTGCAGACTGAGGAGACGAAGAACGCGGA

    TAAGAACGGCCCCATCGGCATCATCAGCGCGATCGGCATCTCCATCCTGG

    TGGGCTGGGGCTACATCCTCGGCATCACCTTCGCGGTGAAGGACATACCC

    TACCTGCTGAGCCCCGACAACGACGCCGGCGGCTACGCCATCGCCGAGGT

    GTTCTACCTCGCCTTCAAGAGCCGCTACGGGAGCGGCGTCGGCGGGATCG

    TCTGCCTGGGGATCGTCGCCGTCGCCATCTACCTGTGCGGCATGAGCTCG

    GTCACCAGCAACTCCAGGATGGCCTACGCGTTCTCGAGGGACGGCGCCAT

    GCCCTTCTCCTCCGTCTGGCACAAGGTCAACAGGCAGGACGTGCCCATCA

    ACGCCGTCTGGCTCTCGGCTTTCATCGCGCTCTGCATGGCGCTCCCGGTA

    AATTGCACTGTGTTGCTGATGACTAGCTGCTTTCTCAATTCTCATCCATG

    TTAATGAATGAATGGTTAATGATAGACAAAAAAAAATGCAGTCTCTGGGC

    AGCCTGGTGGCGTTCCAGGCGATGGTGTCCATCGCCACGGTGGGGCTGTA

    CATCTCGTACGCGCTGCCGGTCCTGTTCCGGGTGACTCTGGCGCGCAAGT

    GCTTCGTGCCGGGGCCCTTCAGCCTGGGCCGCTACGGCGTCATGGTCGGC

    TGGGTCGCTGTGCTCTGGGTGGCCACCATCTCCGTGCTCTTCTCGCTGCC

    GGTCGCGTACCCGGTCACCAAGGACACGCTCAACTACACACCCGTCGCCG

    TCGGCGGCCTCTTCTTCCTCGTCATCGCGTCCTGGGTGCTCAGCGCCAGG

    CACTGGTTCACGGGCCCCATCACCAATCTGGATGGATGAATAAAACTAGA

    CATGCATCACGCATTCATGCATGCCTGACCGAGTGGAGCCCTCGCTCGTC

    GGAGCAGCACTGCCCAGCCACCCACCTCGCGCTCCGCGTGCTTAGAGCAG

    CACTGCCAAACGTGCAAAGTGAACTCAGACAATGTGTCTAACTCCAATTA

    GCGCCGCTTTTGGTCTTGGCTCTACGGCTCTACGCTAATCTGCTTGTACA

    GGCCAAGATATGTAACATGTCTTTGTCTTGCTGTGATATATAGACCAGAG

    TTATTCTATGCTACTATTTGCTATCAAATTTTAGACGAAGGATGCTGAAT

    TTCTTTTACAACATATATATTATGACTTCTCTCGGTAACTTTCATGAATA

    ATTGAGCCCA

     

    Aminoacids sequence: 583 aa (just exons)

    M T W N R S P A G G G S A V T V D H S D D T G L A R L R E L G Y R Q E L K R D L S V L S N F A F S F S I I S V L T G V T T L Y N T G L N F G G P A T M T F G W F V A G A F T M A V G A S M A E I C S S F P T S G G L Y Y W S A R L S G K R W A P F A S W I T G W Y G E T P F S R T P F S F S C K V T A F S L A E P E P I E V L T L T V S L L R A A V Q W A V T T S V D Y S L A Q L I Q V I I L L A T G G K T G G G Y V A S K Y M V L G F H A A I L L S H A V I N S L P I S C L S F L G Q F A A A W N V L G S L P P I L D L S A C T G I I L L L V A A G V F V L M I A V P T V A T E R A S A E F V F T H F N T D N D G A G I R S S L Y I F V L G L L M S Q Y T F T G Y D A S A H M T E E T K N A D K N G P I G I I S A I G I S I L V G W G Y I L G I T F A V K D I P Y L L S P D N D A G G Y A I A E V F Y L A F K S R Y G S G V G G I V C L G I V A V A I Y L C G M S S V T S N S R M A Y A F S R D G A M P F S S V W H K V N R Q D V P I N A V W L S A F I A L C M A L P S L G S L V A F Q A M V S I A T V G L Y I S Y A L P V L F R V T L A R K C F V P G P F S L G R Y G V M V G W V A V L W V A T I S V L F S L P V A Y P V T K D T L N Y T P V A V G G L F F L V I A S W V L S A R H W F T G P I T N L D G

    Was this page helpful?
    Tag page (Edit tags)
    • No tags
    You must login to post a comment.