Was this page helpful?

Evidence for Gene I

    Table of contents
    No headers

    The sequences were blasted against RNA seq reference database. 

    Seq6 vs RNA Seq Ref database.png

    Evidence from the blast against EST database

    ALIGNMENTS

    >gb|DV023755.1| ZM_BFb0143J15.r ZM_BFb Zea mays cDNA 5', mRNA sequence.

    Length=855

     Score =  1463 bits (792),  Expect = 0.0

     Identities = 797/799 (99%), Gaps = 1/799 (0%)

     Strand=Plus/Plus

    Query  1    ATGCTCTGCGAAGGTGGCGACGACAATAATGGCCGCAGCGGCCTAAGGCTCTTCGGAGTG  60

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  58   ATGCTCTGCGAAGGTGGCGACGACAATAATGGCCGCAGCGGCCTAAGGCTCTTCGGAGTG  117

     

    Query  61   CAGGTCCGTATCGGCGGCGGCGGTGGCGCAGGGTCGGCGTCCATGAAGAAGAGCTACAGC  120

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  118  CAGGTCCGTATCGGCGGCGGCGGTGGCGCAGGGTCGGCGTCCATGAAGAAGAGCTACAGC  177

     

    Query  121  ATGGACTGCCTGCAGCTCGCGGCTCCTCATGCTTGTtcgtccctcgtctcgtccccgtcg  180

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  178  ATGGACTGCCTGCAGCTCGCGGCTCCTCATGCTTGTTCGTCCCTCGTCTCGTCCCCGTCG  237

     

    Query  181  tcgtcgtcgttgtgctcgtcctcgtccccgtcgtcgctgctgctgtcgATTGATGATGGG  240

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  238  TCGTCGTCGTTGTGCTCGTCCTCGTCCCCGTCGTCGCTGCTGCTGTCGATTGATGATGGG  297

     

    Query  241  TTGCAGAGAGGGGCGGCCGATGGATACCTGTCTGATGGACCTCATGGCAGAGCTGTGCAG  300

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  298  TTGCAGAGAGGGGCGGCCGATGGATACCTGTCTGATGGACCTCATGGCAGAGCTGTGCAG  357

     

    Query  301  GAGAGGAAGAAAGGAGTTCCATGGAGCGAGGAGGAGCACAGGCAGTTCCTTGCCGGCCTG  360

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  358  GAGAGGAAGAAAGGAGTTCCATGGAGCGAGGAGGAGCACAGGCAGTTCCTTGCCGGCCTG  417

     

    Query  361  GACAAGCTGGGCAAGGGCGACTGGCGAGGCATCGCCAGGAGCTACGTGCCGACGAGGACC  420

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  418  GACAAGCTGGGCAAGGGCGACTGGCGAGGCATCGCCAGGAGCTACGTGCCGACGAGGACC  477

     

    Query  421  CCGACGCAGGTCGCCAGCCACGCGCAGAAGTTCTTCCTCCGGCAGAGCAGCATGGGGAAG  480

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  478  CCGACGCAGGTCGCCAGCCACGCGCAGAAGTTCTTCCTCCGGCAGAGCAGCATGGGGAAG  537

     

    Query  481  AAGAAGCGCCCGGTCCAGCCTCTTCGACATGGTATGCGCATGCAGGCACCAACATCTCTC  540

                |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  538  AAGAAGCG-CCGGTCCAGCCTCTTCGACATGGTATGCGCATGCAGGCACCAACATCTCTC  596

     

    Query  541  TCtttttttttCTGTACGTAATTGCTTGAGTTTTGATAACCGGGTCCAGCGGCAGGTGCC  600

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  597  TCTTTTTTTTTCTGTACGTAATTGCTTGAGTTTTGATAACCGGGTCCAGCGGCAGGTGCC  656

     

    Query  601  GATCTGCGAGAACAGTGCGAGCATCTCCGATCCGCTGGACGTGGCACGCCATGGCGTCGC  660

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  657  GATCTGCGAGAACAGTGCGAGCATCTCCGATCCGCTGGACGTGGCACGCCATGGCGTCGC  716

     

    Query  661  CTCGGCAGACTCCGAGAGGGCGGCCGTGGACGTGGACCTGATGAATTCGACGACGGAGGG  720

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  717  CTCGGCAGACTCCGAGAGGGCGGCCGTGGACGTGGACCTGATGAATTCGACGACGGAGGG  776

     

    Query  721  TGACGACGGCAGGAGCAGGGACGTCGTGTCGTCGGCGTCAGGTGCAGGGACCGCACTGCG  780

                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    Sbjct  777  TGACGACGGCAGGAGCAGGGACGTCGTGTCGTCGGCGTCAGGTGCAGGGACCGCACTGCG  836

     

    Query  781  GTTCCCGGCAGCGGCAGCT  799

                |||||| ||||||||||||

    Sbjct  837  GTTCCCCGCAGCGGCAGCT  855

    Evidence from UNIGENE

    Unigene evidence.png

    GENE FUNCTION Evidence:

    MYB identity.png

    SANT superfamily.png

    conserved domain database hit.png

    Interpro result.png

    MYB motif.png

    Myb motif site.png

    MYB.png

    SANT family.png

    Was this page helpful?
    Tag page (Edit tags)
    • No tags
    You must login to post a comment.