Was this page helpful?

Gene10-6

    Gene10-6

    >Gene10-6:[mRNA] 6 1 exon (s) 79739 - 80191 453 bp, chain -
    ATGGCGCCCAAGGCGGAGAAAAAGCCGGCGGCGAAGAAGCCCGCGGAGGAGGAGCCCGCG
    ACCGAGAAGGCGGAGAAGGCTCCGGCAGGGAAGAAGCCGAAGGCGGAGAAACGCCTCCCC
    GCGGGCAAGTCCGGCGCCGGCGAGGGCAAGAAGGGCAAGAAGAAAGCCAAGAAGAGCGTG
    GAGACCTACAAGATCTACATCTTCAAGGTGCTCAAGCAGGTGCACCCCGACATCGGCATC
    TCGTCCAAGGCCATGTCCATCATGAATTCCTTCATCAACGACATCTTCGAGAAGCTCGCC
    GCGGAGGCCGCCAAGCTCGCCCGCTACAACAAGAAGCCCACCATCACCTCCCGCGAGATC
    CAGACCTCCGTCCGCCTCGTCCTACCCGGCGAGCTCGCCAAGCACGCCGTCTCTGAAGGC
    ACAAAGGCGGTCACCAAGTTCACTTCGTCTTAG

            Both FGENESH and GeneMark softwares predicted this gene which has 1 exon from 79739 - 80191, a total of 453 bp. Using the mRNA sequence blasting with EST and RNAseq database find out this gene have strong EST and RNAseq support which shows below.

    EST supports

    10-6 EST.png

    10-6-EST-2.png

     

     

    RNA-Seq supports

    10-6 RNAseq.png

    10-6 RNAseq-2.png

     

            Extending the region a little further(1kb) to see the BLASTX Plant peptides, no more further matches illustrating our predicted gene is a complete gene.

     

    Predicted Polypeptide: Histone H2B

          Based onthe Blastx and Blastp results, the protein encoded by this gene showed highly homology to histone H2B. Histone H2B (14 kDa),  consists of about 130 amino acid residues, containing about 214 different variants reported in diverse species. Though small,  Histone H2B is a highly conserved nuclear protein, featuring a main globular domain and a long N terminal tail. Histone H2B, together with H2A, H3 and H4, forms the eukaryotic nucleosome core.

    Predicted GO Terms

    Biological Process

    GO:0006334 - nucleosome assembly

    Molecular Function

    GO:0003677 - DNA binding

    Cellular Component

    GO:0000785 - chromatin
    GO:0000786 - nucleosome
    GO:0005634 - nucleus

     

    Top 4 Models Predicted by I-TASSER(I-TASSER results )

    Was this page helpful?
    Tag page (Edit tags)
    • No tags

    Files 4

    FileSizeDateAttached by 
     10-6 EST.png
    No description
    12.19 kB01:28, 8 Dec 2012pingActions
     10-6 RNAseq-2.png
    No description
    103.05 kB01:34, 8 Dec 2012pingActions
     10-6 RNAseq.png
    No description
    12.11 kB01:34, 8 Dec 2012pingActions
     10-6-EST-2.png
    No description
    70.34 kB01:28, 8 Dec 2012pingActions
    You must login to post a comment.