Table of contents
    No headers

    1. microsatellite, Simple sequence repeat (SSR)

    consist of repeating unit 1-6 pairs in length

    from etandem (range size 2-10)

    Start     End   Score   Size  Count Identity Consensus
      22280   22441      96      6     27     81.5 tctcgg  
      14265   14302      36      2     19    100.0 ca      
      56453   56486      32      2     17    100.0 ta      
      54177   54232      32      2     28     80.4 ta      
      77278   77340      30      3     21     76.2 agg     
      48285   48329      30      9      5     93.3 cctttggag
      72335   72427      26      3     31     65.6 tct     
      72177   72242      26      6     11     74.2 ttcgtc  
      22949   23044      26      6     16     66.7 ccaagt  
      53002   53071      26     10      7     75.7 actatcttat
      15084   15119      25      3     12     88.9 ggc     
      65550   65682      24      7     19     61.7 atatttt 
      97840   97935      22      6     16     64.6 attata  
      97154   97291      22      6     23     60.1 aaaaat  
      14525   14548      21      3      8    100.0 gct     
      81664   81759      20      8     12     64.6 aaaattta
      19176   19343      20      8     21     58.3 aatattat

    2. minisatellite

    consist of repeating unit 10-60 pairs in length

    from etandem (range size 10-100)

     Start     End   Score   Size  Count Identity Consensus
      75282   76211     177     93     10     64.5 gagatcttcgattggatgcccgagcggaagatggtgtcctggaacgcgatggtcgcggcctacgcccagaatggccacctcgggcaggcgaag
      22279   22434      88     12     13     82.1 gtctcggtctcg
      25058   25198      82     47      3     95.7 agtatatccaaatctcatcccatgatcacatgcgctacactcaccac
      48266   48499      78     78      3     83.3 ggaggagattcatcttcaaacagaggaggagatctaacctttggagccttcggagcctttggagcatgatggggtggc
      22467   22580      55     57      2     99.1 tccatctcgggtccatctcaaactccatctcggactccgtctcggtccatctcggac
      81655   81997      44     49      7     63.6 taaatttataaaattaatattcataaatattaatattatgataataaaa
      96528   96711      40     92      2     85.9 ctatagacaaggcactctagtagcaaaaggtgtagggagtacccattagacttgtttaagccttaaatcaatggtggtgttagtgagtattg
      97100   97429      32     22     15     58.2 aaaaaaatataataaaatataa
      22944   23051      30     12      9     69.4 tgagaccaagtc
      14265   14304      28     10      4     97.5 cacacacaca
      53002   53071      26     10      7     75.7 actatcttat
      96175   96274      26     50      2     88.0 aagcaagaataaaacttctaaaaaagtgtttaaggaacaagtctaaattc
      25528   25577      25     25      2    100.0 tcgaactattgtcaatccatttccg
      54173   54232      24     10      6     78.3 tatatatata
      77276   77335      24     12      5     80.0 ggaggatgacga
      72309   72392      23     21      4     76.2 cttcatcgtcgtcttcctcat
      25581   25678      23     49      2     86.7 tcattctaccaatccttcaattgttaatcgaaccattgtcaatccatgc
      56453   56488      22     12      3     97.2 tatatatatata
      89650   89817      20     12     14     59.5 cctctccaccac

    Was this page helpful?
    Tag page (Edit tags)
    • No tags
    You must login to post a comment.