Table of contents
    No headers

    General Information

    Scaffold: 2 

    Base Pairs: 99,353 

    Molecular Weight: 30689.39 KDa

    GC Content: 45.14%

    Run of N's: 50,857-51,117 bp

     

    Dotplot:

    dottup.1.png

     

    eTandem Results:

    Start     End   Score   Size  Count Identity Consensus
    31736   31995      20     10     26     55.8  ttattttaaa

    >eTandem eTandem undefined product 31736:31995 forward
    ttatttaacattaaacataatgagatttaagaacttcacattataagttataattaacct
    tgtttaaataataaataaattttttttatcttattttatatttaatttatttttctaatc
    tttcttattgaaaatttagtaaaaatctatttaattgaagagaaaataaagtatttttaa
    tagaaaaggaaagtgaaatattttcatagtaaatttcacattatttattagttatattaa
    atattttacattattgcaaa

     


    [1]

    Was this page helpful?
    Tag page (Edit tags)
    • No tags

    Files 34

    FileSizeDateAttached by 
     Artemis Tutorial.pdf
    No description
    224.67 kB15:23, 30 Oct 2008csilvaActions
     blastp of genscan maize.docx
    No description
    845.12 kB15:06, 12 Dec 2008jbrazeltActions
     FgeneSH and Genescan gene prediction 1.docx
    No description
    107.88 kB15:47, 12 Dec 2008csilvaActions
     FgeneSH output file
    No description
    513.79 kB20:44, 3 Nov 2008csilvaActions
     Fgenesh_smo10.docx
    No description
    109.32 kB21:44, 15 Dec 2008csilvaActions
     Fgenesh_smo2.docx
    No description
    117.55 kB17:46, 13 Dec 2008csilvaActions
     Fgenesh_smo3.docx
    No description
    83.47 kB17:44, 13 Dec 2008csilvaActions
     Fgenesh_smo4.docx
    No description
    86.63 kB15:45, 14 Dec 2008csilvaActions
     Fgenesh_smo5.docx
    No description
    221.05 kB16:15, 14 Dec 2008csilvaActions
     Fgenesh_smo7.docx
    No description
    93.61 kB17:21, 14 Dec 2008csilvaActions
     Fgenesh_smo9.docx
    No description
    129.18 kB21:17, 15 Dec 2008csilvaActions
     Genescan 12.docx
    genescan 12 and fgenesh 14 and 15
    247.46 kB15:59, 14 Dec 2008jbrazeltActions
     Genescan 14.docx
    genescan 14 and fgenesh 17
    164.27 kB16:00, 14 Dec 2008jbrazeltActions
     Genescan 16 and fgenesh 20.docx
    genescan 16 and fgenesh 20
    154.8 kB16:00, 14 Dec 2008jbrazeltActions
     Genescan 17.docx
    No description
    61.24 kB16:00, 14 Dec 2008jbrazeltActions
     Genescan 18.docx
    No description
    88.58 kB16:00, 14 Dec 2008jbrazeltActions
     Genescan 19.docx
    No description
    96.84 kB16:00, 14 Dec 2008jbrazeltActions
     Genescan 20.docx
    No description
    70.41 kB16:01, 14 Dec 2008jbrazeltActions
     genescan11 and fgenesh13.docx
    Genescan 11 and fgenesh 13
    143.21 kB15:59, 14 Dec 2008jbrazeltActions
     Genescan13.docx
    genescan 13 and fgenesh 16
    165.56 kB15:59, 14 Dec 2008jbrazeltActions
     Genescan15.docx
    genescan 15 and fgenesh 18 and 19
    191.56 kB16:00, 14 Dec 2008jbrazeltActions
     Genescan_smo10 and Fgenesh_smo12.docx
    No description
    168.62 kB22:07, 15 Dec 2008csilvaActions
     genescan_smo2.docx
    No description
    149.05 kB14:36, 13 Dec 2008csilvaActions
     Genescan_smo3.docx
    No description
    53.81 kB17:44, 13 Dec 2008csilvaActions
    Genescan_smo4.docx
    No description
    468.13 kB15:32, 14 Dec 2008csilvaActions
     Genescan_smo5 and Fgenesh_smo6.docx
    No description
    200.19 kB16:41, 14 Dec 2008csilvaActions
     Genescan_smo6.docx
    No description
    223.76 kB17:07, 14 Dec 2008csilvaActions
     Genescan_smo7 and Fgenesh_smo8.docx
    No description
    160 kB20:30, 15 Dec 2008csilvaActions
     Genescan_smo8.docx
    No description
    181.08 kB21:06, 15 Dec 2008csilvaActions
     Genescan_smo9 and Fgenesh_smo11.docx
    No description
    104.78 kB21:53, 15 Dec 2008csilvaActions
     GENSCANW output for arabidopsis.doc
    No description
    98.5 kB16:08, 19 Nov 2008jbrazeltActions
     genscanw output for maize.doc
    No description
    80 kB16:08, 19 Nov 2008jbrazeltActions
     smo_gene_model_alignment.xls
    No description
    87.5 kB15:10, 14 Dec 2008csilvaActions
     tblastn of genscan maize.docx
    No description
    755.42 kB15:06, 12 Dec 2008jbrazeltActions
    You must login to post a comment.